Abstract
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 Å resolution. The oligonucleotide was crystallized at 277 K using poly-ethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 Å, α = 91.37, β = 93.21, γ = 92.35°.
Original language | English |
---|---|
Pages (from-to) | 539-541 |
Number of pages | 3 |
Journal | Acta Crystallographica Section F: Structural Biology and Crystallization Communications |
Volume | 66 |
Issue number | 5 |
DOIs | |
State | Published - 29 Apr 2010 |
Keywords
- DNA heptacosamer
- Oligonucleotides