Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus

Research output: Contribution to journalArticlepeer-review

Abstract

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 Å resolution. The oligonucleotide was crystallized at 277 K using poly-ethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 Å, α = 91.37, β = 93.21, γ = 92.35°.

Original languageEnglish
Pages (from-to)539-541
Number of pages3
JournalActa Crystallographica Section F: Structural Biology and Crystallization Communications
Volume66
Issue number5
DOIs
StatePublished - 29 Apr 2010

Keywords

  • DNA heptacosamer
  • Oligonucleotides

Fingerprint

Dive into the research topics of 'Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus'. Together they form a unique fingerprint.

Cite this